Stem-loop sequence hsa-mir-2355

Accession

MI0015873

Description

Homo sapiens miR-2355 stem-loop

Gene family

MIPF0000938; mir-2355

Stem-loop

--   ac    c   c       -   u     au       uau 
  cag  gugu auc ccagaua caa ggaca  augcuau   a
  |||  |||| ||| ||||||| ||| |||||  |||||||   a
  guc  caua uag gguuugu guu ccugu  uacggua   u
ca   gu    a   a       c   -     --       ugc 

Deep sequencing

79 reads, 13 experiments

Genome context

• Coordinates (GRCh37.p5): chr2: 207974711-207974797 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000336786 ; KLF7-005; intron 1

  OTTHUMT00000336786 ; KLF7-005; intron 1

  OTTHUMT00000336786 ; KLF7-005; intron 1

  OTTHUMT00000336783 ; KLF7-002; intron 2

  OTTHUMT00000336790 ; KLF7-009; intron 2

  OTTHUMT00000256466 ; KLF7-001; intron 2

  OTTHUMT00000336783 ; KLF7-002; intron 2

  OTTHUMT00000336790 ; KLF7-009; intron 2

  OTTHUMT00000256466 ; KLF7-001; intron 2

  OTTHUMT00000336783 ; KLF7-002; intron 2

  OTTHUMT00000336790 ; KLF7-009; intron 2

  OTTHUMT00000256466 ; KLF7-001; intron 2

  OTTHUMT00000336784 ; KLF7-003; intron 3

  OTTHUMT00000336784 ; KLF7-003; intron 3

  OTTHUMT00000336784 ; KLF7-003; intron 3

  ENST00000467833 ; KLF7-005; intron 1

  ENST00000467833 ; KLF7-005; intron 1

  ENST00000467833 ; KLF7-005; intron 1

  ENST00000309446 ; KLF7-001; intron 2

  ENST00000421199 ; KLF7-002; intron 2

  ENST00000458272 ; KLF7-009; intron 2

  ENST00000412414 ; KLF7-201; intron 2

  ENST00000309446 ; KLF7-001; intron 2

  ENST00000421199 ; KLF7-002; intron 2

  ENST00000458272 ; KLF7-009; intron 2

  ENST00000412414 ; KLF7-201; intron 2

  ENST00000309446 ; KLF7-001; intron 2

  ENST00000421199 ; KLF7-002; intron 2

  ENST00000458272 ; KLF7-009; intron 2

  ENST00000412414 ; KLF7-201; intron 2

  ENST00000423015 ; KLF7-003; intron 3

  ENST00000423015 ; KLF7-003; intron 3

  ENST00000423015 ; KLF7-003; intron 3

Database links

• ENTREZGENE: 100423036;MIR2355

Mature sequence hsa-miR-2355-5p

• Accession: MIMAT0016895
• Previous IDs: hsa-miR-2355
• Sequence: 11 - auccccagauacaauggacaa - 31
• Deep sequencing: 68 reads, 10 experiments
• Evidence: experimental; SOLiD [1], Solexa [2-3,5], Northern [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-2355-5p
  • MICRORNA.ORG:hsa-miR-2355-5p
  • MIRDB:hsa-miR-2355-5p
  • RNA22-HSA:hsa-miR-2355-5p
  • TARGETMINER:hsa-miR-2355-5p

Mature sequence hsa-miR-2355-3p

• Accession: MIMAT0017950
• Sequence: 54 - auuguccuugcuguuuggagau - 75
• Deep sequencing: 11 reads, 6 experiments
• Evidence: experimental; Solexa [2-3,5], Northern [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-2355-3p
  • MIRDB:hsa-miR-2355-3p
  • RNA22-HSA:hsa-miR-2355-3p
  • TARGETMINER:hsa-miR-2355-3p

References

1. PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
4. PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
5. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).