Stem-loop sequence hsa-mir-4301

AccessionMI0015828 (change log)
Symbol HGNC:MIR4301
DescriptionHomo sapiens miR-4301 stem-loop
Literature search

2 open access papers mention hsa-mir-4301
(10 sentences)

Stem-loop
   acc   --     c     a      uu   aa 
5'    agc  caccu ccacu cuucac  gug  c
      |||  ||||| ||||| ||||||  |||  a
3'    ucg  gugga ggugg gaggug  uac  u
   guc   ac     c     -      cu   gu 
Get sequence
Deep sequencing
1740 reads, 8.05 reads per million, 87 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 113450023-113450088 [-]
intergenic
Database links

Mature sequence hsa-miR-4301

Accession MIMAT0016850
Sequence

11 - 

ucccacuacuucacuuguga

 - 30

Get sequence
Deep sequencing1734 reads, 99 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).