Stem-loop sequence cin-let-7f

AccessionMI0015777 (change log)
DescriptionCiona intestinalis let-7f stem-loop
Literature search

3 open access papers mention cin-let-7f
(18 sentences)

Stem-loop
   -u     a     uuc       -   g   guuaa 
5'   gaggu gugga   uguaguu uuu cuc     a
     ||||| |||||   ||||||| ||| |||     u
3'   cucua caccu   acgucaa gga gag     g
   ug     c     uac       u   g   accga 
Get sequence
Deep sequencing
4495 reads, 1.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 2082406-2082478 [+]
intergenic
Clustered miRNAs
< 10kb from cin-let-7f
cin-let-7a-14q: 2082260-2082369 [+]
cin-let-7f4q: 2082406-2082478 [+]
cin-let-7b4q: 2082788-2082896 [+]
cin-let-7c4q: 2082979-2083088 [+]
cin-let-7a-24q: 2083177-2083286 [+]
Database links

Mature sequence cin-let-7f-5p

Accession MIMAT0016842
Sequence

1 - 

ugagguaguggauucugu

 - 18

Get sequence
Deep sequencing4495 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-let-7f-3p

Accession MIMAT0016843
Sequence

53 - 

cugcacauuccaccaucucgu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1