Stem-loop sequence cin-mir-4084

AccessionMI0015637 (change log)
DescriptionCiona intestinalis miR-4084 stem-loop
Stem-loop
   -           cu  a      ---    a   cua 
5'  agaucuucugg  au guuugu   uuga cuu   u
    |||||||||||  || ||||||   |||| |||   u
3'  uuuagaagacu  ua caaaca   aacu gaa   c
   c           au  a      uaa    a   uuu 
Get sequence
Deep sequencing
139 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 6737327-6737399 [-]
intergenic
scaffold_105: 278344-278416 [+]
intergenic
Database links

Mature sequence cin-miR-4084-5p

Accession MIMAT0016657
Sequence

1 - 

agaucuucuggcuauaguuu

 - 20

Get sequence
Deep sequencing138 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4084-3p

Accession MIMAT0016658
Sequence

53 - 

aaacaauuaucagaagauuuc

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1