Stem-loop sequence cin-mir-4078

AccessionMI0015631 (change log)
DescriptionCiona intestinalis miR-4078 stem-loop
Stem-loop
   c       ga      g     gu 
5'  cuuguag  guaaag gaaac  u
    |||||||  |||||| |||||  u
3'  ggacguc  cguuuc cuuug  a
   u       ac      a     ac 
Get sequence
Deep sequencing
181 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_44: 426304-426354 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4078
cin-mir-4078scaffold_44: 426304-426354 [-]
cin-mir-4060scaffold_44: 426196-426250 [-]
Database links

Mature sequence cin-miR-4078-5p

Accession MIMAT0016645
Sequence

1 - 

ccuuguaggaguaaagggaa

 - 20

Get sequence
Deep sequencing179 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4078-3p

Accession MIMAT0016646
Sequence

32 - 

uucacuuugccacugcaggu

 - 51

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1