Stem-loop sequence cin-mir-4060

AccessionMI0015611 (change log)
DescriptionCiona intestinalis miR-4060 stem-loop
Stem-loop
           c uu    u     ucga 
5' auuucacu u  caac guugg    a
   |||||||| |  |||| |||||    a
3' ugaaguga g  guug cgacc    u
           c uu    c     uaua 
Get sequence
Deep sequencing
267 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_44: 426196-426250 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4060
cin-mir-4078scaffold_44: 426304-426354 [-]
cin-mir-4060scaffold_44: 426196-426250 [-]
Database links

Mature sequence cin-miR-4060-5p

Accession MIMAT0016608
Sequence

1 - 

auuucacucuuucaacuguu

 - 20

Get sequence
Deep sequencing167 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4060-3p

Accession MIMAT0016609
Sequence

36 - 

agccguuguugcagugaagu

 - 55

Get sequence
Deep sequencing100 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1