Stem-loop sequence cin-mir-4013a

AccessionMI0015557 (change log)
DescriptionCiona intestinalis miR-4013a stem-loop
Stem-loop
   aga      a       augcgu   u 
5'    cuugua uagcagc      cgg u
      |||||| |||||||      ||| a
3'    gaacgu aucgucg      gcc a
   ccc      a       ---gau   a 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_44: 845403-845456 [+]
intergenic
Database links

Mature sequence cin-miR-4013a-5p

Accession MIMAT0016514
Sequence

1 - 

agacuuguaauagcagcaug

 - 20

Get sequence
Deep sequencing11 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4013a-3p

Accession MIMAT0016515
Sequence

35 - 

uaggcugcuaaugcaagccc

 - 54

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1