Stem-loop sequence cin-mir-4008a

AccessionMI0015545 (change log)
DescriptionCiona intestinalis miR-4008a stem-loop
Stem-loop
   u     uaugc   a u          u  aa 
5'  ggcag     gca g uaggcccuuu gu  u
    |||||     ||| | |||||||||| ||   
3'  ccguc     ugu c auuugggaaa ca  a
   a     -----   c u          -  gu 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
10q: 2149015-2149074 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4008a
cin-mir-3410q: 2152513-2152631 [-]
cin-mir-409110q: 2150745-2150829 [-]
cin-mir-4008a10q: 2149015-2149074 [-]
cin-mir-4008c10q: 2148809-2148870 [-]
cin-mir-4008b10q: 2148360-2148421 [-]
cin-mir-405410q: 2148145-2148201 [-]
Database links

Mature sequence cin-miR-4008a-5p

Accession MIMAT0016495
Sequence

1 - 

uggcaguaugcgcaaguuag

 - 20

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4008a-3p

Accession MIMAT0016496
Sequence

41 - 

aggguuuauccugucugcca

 - 60

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1