Stem-loop sequence cin-mir-375

AccessionMI0015493 (change log)
DescriptionCiona intestinalis miR-375 stem-loop
Literature search

1 open access papers mention cin-mir-375
(1 sentences)

Stem-loop
       u     c    u   a    cauuauuguucuggcg 
5' acgu ggucg acga caa gcgu                u
   |||| ||||| |||| ||| ||||                c
3' ugcg ucggc ugcu guu cgua                a
       c     u    u   c    aaauacugcguuaauu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 439603-439685 [+]
intergenic
Database links

Mature sequence cin-miR-375-5p

Accession MIMAT0016417
Sequence

1 - 

acguuggucgcacgaucaaa

 - 20

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-375-3p

Accession MIMAT0016418
Sequence

64 - 

cuuguucguucggcucgcgu

 - 83

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1