Stem-loop sequence rno-mir-3120

AccessionMI0015476 (change log)
DescriptionRattus norvegicus miR-3120 stem-loop
Gene family MIPF0000062; mir-214
Literature search

2 open access papers mention rno-mir-3120
(2 sentences)

Stem-loop
   -  u  ucauuca   u             a           ug c      a    ugag 
5'  gg ug       ggc ggguugucaugug cugccugucug  c ugcugu cagg    c
    || ||       ||| ||||||||||||| |||||||||||  | |||||| ||||    g
3'  cc ac       cug cucaacaguacac gacggacagau  g acgaca gucu    g
   a  u  -------   u             a           gu a      c    ugua 
Get sequence
Deep sequencing
308 reads, 16.9 reads per million, 130 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 80130909-80131025 [-]
sense
ENSRNOT00000064219 ; Dnm3-204; intron 14
ENSRNOT00000068490 ; Dnm3-201; intron 15
ENSRNOT00000047799 ; Dnm3-202; intron 15
ENSRNOT00000067653 ; Dnm3-203; intron 15
ENSRNOT00000041058 ; Dnm3-205; intron 15
Clustered miRNAs
< 10kb from rno-mir-3120
rno-mir-3120chr13: 80130909-80131025 [-]
rno-mir-214chr13: 80130905-80131014 [+]
rno-mir-199achr13: 80125487-80125596 [+]
Database links

Mature sequence rno-miR-3120

Accession MIMAT0017900
Sequence

72 - 

cacagcaaguguagacaggca

 - 92

Get sequence
Deep sequencing277 reads, 120 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).