Stem-loop sequence rno-mir-3592

AccessionMI0015473 (change log)
DescriptionRattus norvegicus miR-3592 stem-loop
Gene family MIPF0001166; mir-3578
Literature search

1 open access papers mention rno-mir-3592
(1 sentences)

Stem-loop
   -   -  uagaggua  a  ----       -   aaaagu     c    aau       caca 
5'  guc cu        gc uu    ugguacu gaa      guugu cgug   gauucgu    a
    ||| ||        || ||    ||||||| |||      ||||| ||||   |||||||     
3'  cag ga        cg aa    accauga cuu      caaca gcac   cuaagcg    g
   a   a  --------  a  agac       a   -cucuu     a    cac       aaau 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133884161-133884276 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3592
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-381chr6: 133876615-133876675 [+]
Database links

Mature sequence rno-miR-3592

Accession MIMAT0017895
Sequence

31 - 

aaguguuguccgugaaugauu

 - 51

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).