Stem-loop sequence rno-mir-344b-1

AccessionMI0015472 (change log)
DescriptionRattus norvegicus miR-344b-1 stem-loop
Gene family MIPF0000267; mir-344
Literature search

8 open access papers mention rno-mir-344b-1
(36 sentences)

Stem-loop
   ag    - --------------ugau     a    gc         u        u 
5'   agac c                  caguc ggcu  ugguuauau ccaggacu c
     |||| |                  ||||| ||||  ||||||||| |||||||| u
3'   ucug g                  gucag ccga  accaauaua gguccugg c
   --    u uaagaaugaaaauaaauu     c    -a         -        u 
Get sequence
Deep sequencing
18070 reads, 24.1 reads per million, 166 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 121193138-121193235 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-344b-1
rno-mir-344b-3chr1: 121201252-121201322 [-]
rno-mir-344b-1chr1: 121193138-121193235 [-]
rno-mir-344b-2chr1: 121185891-121185961 [-]
Database links

Mature sequence rno-miR-344b-5p

Accession MIMAT0017811
Sequence

13 - 

agucaggcugcugguuauauuc

 - 34

Get sequence
Deep sequencing4129 reads, 84 experiments
Evidence experimental; SOLiD [1]

Mature sequence rno-miR-344b-1-3p

Accession MIMAT0017894
Sequence

54 - 

gauauaaccaaagcccgacugu

 - 75

Get sequence
Deep sequencing16677 reads, 159 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).