Stem-loop sequence rno-mir-1249

AccessionMI0015470 (change log)
DescriptionRattus norvegicus miR-1249 stem-loop
Gene family MIPF0000667; mir-1249
Literature search

1 open access papers mention rno-mir-1249
(1 sentences)

Stem-loop
   -     cu cuc   -uucuu      au  -         a     u    caa     cua 
5'  ucuug  g   cga      guuugc  gg ggaggaggg gggga gggc   guucc   u
    |||||  |   |||      ||||||  || ||||||||| ||||| ||||   |||||    
3'  agaac  c   gcu      caagcg  cc cuucuuccc ccccu cccg   caagg   g
   c     uu -cu   cauccu      gu  a         -     u    ---     ucc 
Get sequence
Deep sequencing
64183 reads, 28.1 reads per million, 466 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 125861192-125861311 [-]
sense
ENSRNOT00000042070 ; RGD1304694-201; intron 7
Database links

Mature sequence rno-miR-1249

Accession MIMAT0017892
Sequence

69 - 

acgcccuucccccccuucuuca

 - 90

Get sequence
Deep sequencing64148 reads, 466 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).