Stem-loop sequence rno-mir-3590

AccessionMI0015468 (change log)
DescriptionRattus norvegicus miR-3590 stem-loop
Literature search

1 open access papers mention rno-mir-3590
(1 sentences)

Stem-loop
        au  c     a      ca     c -g   a 
5' ggccg  gc cuuuu acauug  cugcu g  uac c
   |||||  || ||||| ||||||  ||||| |  |||  
3' ccggc  cg gaaaa uguaac  gauga c  aug g
        cu  a     g      ac     - ag   u 
Get sequence
Deep sequencing
849 reads, 0 reads per million, 166 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 72141044-72141117 [+]
antisense
ENSRNOT00000053693 ; Mir130a-201; exon 1
ENSRNOT00000009903 ; Smtnl1-201; intron 8
Clustered miRNAs
< 10kb from rno-mir-3590
rno-mir-130achr3: 72141037-72141124 [-]
rno-mir-3590chr3: 72141044-72141117 [+]
Database links

Mature sequence rno-miR-3590-5p

Accession MIMAT0017889
Sequence

7 - 

ugcccuuuuaacauugcacug

 - 27

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-3590-3p

Accession MIMAT0017890
Sequence

48 - 

uagcacaaugugaaaagagcuc

 - 69

Get sequence
Deep sequencing844 reads, 165 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).