Stem-loop sequence rno-mir-3589

AccessionMI0015467 (change log)
DescriptionRattus norvegicus miR-3589 stem-loop
Stem-loop
       ---cg  c      a   u    a a  aaa    c         ----- -   a 
5' ucca     aa uuggug uac ccag g gg   ccag aaguguuga     c gcu a
   ||||     || |||||| ||| |||| | ||   |||| |||||||||     | ||| c
3' aggu     uu aacuac gug gguc c cc   gguc uucauaacu     g cgg c
       cauca  u      -   -    a c  cuc    c         acaaa a   u 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 143516992-143517103 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3589
rno-mir-3589chrX: 143516992-143517103 [+]
rno-mir-505chrX: 143517014-143517080 [-]
Database links

Mature sequence rno-miR-3589

Accession MIMAT0017888
Sequence

26 - 

gaggaaaccagcaaguguugac

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).