Stem-loop sequence rno-mir-3588

AccessionMI0015466 (change log)
DescriptionRattus norvegicus miR-3588 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention rno-mir-3588
(7 sentences)

Stem-loop
       -uggu   --u  ccg     g    -a   g            u  uac 
5' cugc     acc   cu   ccuag uccc  aga ccugacuuguga gu   u
   ||||     |||   ||   ||||| ||||  ||| |||||||||||| ||   a
3' gacg     ugg   ga   ggauc aggg  ucu ggauugaacacu ca   a
       uaguu   ucu  aaa     -    ac   g            c  uaa 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 16097337-16097442 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3588
rno-mir-125b-2chr11: 16097346-16097433 [+]
rno-mir-3588chr11: 16097337-16097442 [-]
Database links

Mature sequence rno-miR-3588

Accession MIMAT0017887
Sequence

60 - 

ucacaaguuagggucucaggga

 - 81

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).