Stem-loop sequence rno-mir-702

AccessionMI0015464 (change log)
DescriptionRattus norvegicus miR-702 stem-loop
Gene family MIPF0001163; mir-702
Literature search

5 open access papers mention rno-mir-702
(10 sentences)

Stem-loop
   ----- u           uu  ca     -   cca  cu  -    -  --  c    u 
5'      g gaguggggugg  gg  ugggu ugc   gu  gg ggac uc  ga gcug g
        | |||||||||||  ||  ||||| |||   ||  || |||| ||  || |||| u
3'      c cucaccccauu  cc  acccg acg   ca  cc ccug ag  cu cgac c
   cggga -           uc  --     u   ---  cu  u    u  uc  c    a 
Get sequence
Deep sequencing
17198 reads, 4.6 reads per million, 435 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr12: 22721846-22721952 [-]
sense
ENSRNOT00000001921 ; Plod3-201; exon 14
antisense
ENSRNOT00000040015 ; Znhit1-201; intron 1
Database links

Mature sequence rno-miR-702-5p

Accession MIMAT0017884
Sequence

1 - 

gugaguggggugguuggcaug

 - 21

Get sequence
Deep sequencing252 reads, 118 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-702-3p

Accession MIMAT0017885
Sequence

81 - 

ugcccacccuuuaccccacucca

 - 103

Get sequence
Deep sequencing16927 reads, 432 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).