Stem-loop sequence rno-mir-219b

AccessionMI0015462 (change log)
DescriptionRattus norvegicus miR-219b stem-loop
Gene family MIPF0000044; mir-219
Literature search

26 open access papers mention rno-mir-219b
(215 sentences)

Stem-loop
   a   -   -a   ca     a   -      c a       ------------   u 
5'  gac cgg  gcu  accac gau guccag c caauucu            cgg u
    ||| |||  |||  ||||| ||| |||||| | |||||||            |||  
3'  uug guc  cga  uggug cua cagguu g guuaaga            gcc g
   -   a   cc   ag     a   a      u c       acaugcucagac   g 
Get sequence
Deep sequencing
588 reads, 0 reads per million, 244 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 8407427-8407526 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-219b
rno-mir-219bchr3: 8407427-8407526 [+]
rno-mir-219a-2chr3: 8407430-8407525 [-]
Database links

Mature sequence rno-miR-219b

Accession MIMAT0017882
Sequence

19 - 

agauguccagccacaauucucg

 - 40

Get sequence
Deep sequencing296 reads, 160 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).