Stem-loop sequence rno-mir-3585

AccessionMI0015460 (change log)
DescriptionRattus norvegicus miR-3585 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention rno-mir-3585
(2 sentences)

Stem-loop
            a   aau -   -     g            g    u   u      ggga 
5' gccacaugg gca   c ugu gugca ugcuuuucacaa aagg guc uucaug    u
   ||||||||| |||   | ||| ||||| |||||||||||| |||| ||| ||||||     
3' ugguguguc cgu   g aca caugu augaggaguguu uucc cgg aaguac    u
            -   aau u   a     a            g    -   c      aaaa 
Get sequence
Deep sequencing
115561 reads, 402 reads per million, 442 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 155344176-155344293 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3585
rno-mir-547chrX: 155338841-155338921 [+]
rno-mir-201chrX: 155339140-155339219 [+]
rno-mir-3585chrX: 155344176-155344293 [+]
Database links

Mature sequence rno-miR-3585-5p

Accession MIMAT0017878
Sequence

32 - 

uucacaagaaggugucuuucau

 - 53

Get sequence
Deep sequencing95748 reads, 436 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-3585-3p

Accession MIMAT0017879
Sequence

67 - 

ugaacggcccuuguuguga

 - 85

Get sequence
Deep sequencing19803 reads, 312 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).