Stem-loop sequence rno-mir-3596c

AccessionMI0015459 (change log)
DescriptionRattus norvegicus miR-3596c stem-loop
Gene family MIPF0001194; mir-3596
Literature search

3 open access papers mention rno-mir-3596c
(3 sentences)

Stem-loop
   c   uu  ag   agg    ag      gaa  c       cc       -  ucuccuc   u 
5'  ccc  cc  ugc   gcgc  ccuggg   ag uaggagg  guauagu ga       ggg g
    |||  ||  |||   ||||  ||||||   || |||||||  ||||||| ||       ||| u
3'  ggg  gg  acg   cgcg  gggccc   uc auccucc  cauauca cu       ccu c
   -   -u  --   --g    gg      gac  c       aa       a  -------   u 
Get sequence
Deep sequencing
51 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 59704372-59704488 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3596c
rno-mir-125achr1: 59704827-59704911 [+]
rno-let-7echr1: 59704381-59704473 [+]
rno-mir-3596cchr1: 59704372-59704488 [-]
rno-mir-99bchr1: 59704216-59704285 [+]
Database links

Mature sequence rno-miR-3596c

Accession MIMAT0017877
Sequence

74 - 

acuauacaaccuccuaccuca

 - 94

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).