Stem-loop sequence rno-mir-133c

AccessionMI0015456 (change log)
DescriptionRattus norvegicus miR-133c stem-loop
Gene family MIPF0000029; mir-133
Literature search

61 open access papers mention rno-mir-133c
(223 sentences)

Stem-loop
   -  ug  uguccu      auca    aua    c       u   g           - auu 
5'  gc  gc      guggca    augc   gcua agcuggu gaa gggaccaaauc c   g
    ||  ||      ||||||    ||||   |||| ||||||| ||| ||||||||||| |   a
3'  ug  cg      cgccgu    uacg   cgau ucgacca uuu ccuugguuuag g   a
   u  gu  -----u      ----    aaa    u       u   a           c gag 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 2052459-2052576 [+]
sense
ENSRNOT00000018025 ; Mib1-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-133c
rno-mir-133cchr18: 2052459-2052576 [+]
rno-mir-133achr18: 2052478-2052564 [-]
rno-mir-3571chr18: 2054922-2055032 [+]
rno-mir-1chr18: 2054933-2055019 [-]
Database links

Mature sequence rno-miR-133c

Accession MIMAT0017872
Sequence

34 - 

cagcugguugaaggggaccaa

 - 54

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).