Stem-loop sequence rno-mir-3578

AccessionMI0015451 (change log)
DescriptionRattus norvegicus miR-3578 stem-loop
Gene family MIPF0001166; mir-3578
Stem-loop
   u   ca    ga    ------  a    -   aaa     a   a   au      --a  u 
5'  cuc  agcu  gcau      ug uacu gag   agauc acc ugu  uauucg   ag c
    |||  ||||  ||||      || |||| |||   ||||| ||| |||  ||||||   ||  
3'  gag  ucga  cgug      ac auga cuu   ucuag ugg aca  auaagc   uc a
   g   --    gc    gagacg  c    a   ccc     c   c   au      gaa  g 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133893672-133893788 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3578
rno-mir-3072chr6: 133898795-133898905 [+]
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
Database links

Mature sequence rno-miR-3578

Accession MIMAT0017866
Sequence

62 - 

gcgaauauaacacggucgaucu

 - 83

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).