Stem-loop sequence rno-mir-1912

AccessionMI0015450 (change log)
DescriptionRattus norvegicus miR-1912 stem-loop
Gene family MIPF0000768; mir-1912
Stem-loop
   a          ggau  g           gg  a    gauuu 
5'  cuagucucua    gu cucauugcaug  cu ugua     c
    ||||||||||    || |||||||||||  || ||||     u
3'  gguuagagau    ca gagugacguac  ga acau     a
   -          aguu  a           aa  c    aauuu 
Get sequence
Deep sequencing
1587 reads, 0 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 118130652-118130739 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-1912
rno-mir-3552chrX: 118121374-118121478 [+]
rno-mir-764chrX: 118123251-118123358 [+]
rno-mir-1912chrX: 118130652-118130739 [+]
Database links

Mature sequence rno-miR-1912-5p

Accession MIMAT0017864
Sequence

17 - 

ugcucauugcaugggcuaugu

 - 37

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-1912-3p

Accession MIMAT0017865
Sequence

54 - 

cacagaacaugcagugaga

 - 72

Get sequence
Deep sequencing1581 reads, 75 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).