Stem-loop sequence rno-mir-1193

AccessionMI0015445 (change log)
DescriptionRattus norvegicus miR-1193 stem-loop
Gene family MIPF0000714; mir-1193
Literature search

1 open access papers mention rno-mir-1193
(1 sentences)

Stem-loop
       ----     -u  uc  a    a    u a          - c      g    - uuc 
5' ggug    cuuac  gc  uc gggu gcug g ggaugguaaa c ggugac ugca c   a
   ||||    |||||  ||  || |||| |||| | |||||||||| | |||||| |||| |   u
3' ccau    gggug  ug  ag ccca cgac c ccuaucauuu g ccacug augu g   u
       agua     uc  cc  a    -    - g          u c      g    c uau 
Get sequence
Deep sequencing
9171 reads, 1.76 reads per million, 341 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133864698-133864817 [+]
sense
ENSRNOT00000054600 ; rno-mir-679-201; exon 1
ENSRNOT00000063357 ; Mir1193-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-1193
rno-mir-379chr6: 133857700-133857784 [+]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
Database links

Mature sequence rno-miR-1193-5p

Accession MIMAT0017858
Sequence

32 - 

augguaaaccggugacgugc

 - 51

Get sequence
Deep sequencing26 reads, 20 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-1193-3p

Accession MIMAT0017859
Sequence

67 - 

uaggucacccguuuuacuaucc

 - 88

Get sequence
Deep sequencing9142 reads, 340 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).