Stem-loop sequence rno-mir-1188

AccessionMI0015443 (change log)
DescriptionRattus norvegicus miR-1188 stem-loop
Gene family MIPF0001188; mir-1188
Literature search

4 open access papers mention rno-mir-1188
(7 sentences)

Stem-loop
   -    c     ----u      ag uu     -a   u  aa c 
5'  gucu ucagc     ggugug  g  gggcc  gga ga  c c
    |||| |||||     ||||||  |  |||||  ||| ||  |  
3'  caga agucg     ccacac  c  cucgg  ccu cu  g a
   u    -     ucguc      ca cc     ag   -  cg a 
Get sequence
Deep sequencing
581 reads, 0 reads per million, 96 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133733578-133733659 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-1188
rno-mir-341chr6: 133733240-133733335 [+]
rno-mir-1188chr6: 133733578-133733659 [+]
rno-mir-370chr6: 133739916-133739994 [+]
Database links

Mature sequence rno-miR-1188-5p

Accession MIMAT0017854
Sequence

11 - 

uggugugagguugggccagga

 - 31

Get sequence
Deep sequencing414 reads, 88 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-1188-3p

Accession MIMAT0017855
Sequence

49 - 

cgaggcuccccaccaca

 - 65

Get sequence
Deep sequencing160 reads, 57 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).