Stem-loop sequence rno-mir-3572

AccessionMI0015442 (change log)
DescriptionRattus norvegicus miR-3572 stem-loop
Gene family MIPF0001244; mir-3572
Literature search

1 open access papers mention rno-mir-3572
(1 sentences)

Stem-loop
   u     cagu  g    ggcc           --c        -        ua  u 
5'  gccac    aa ugga    aguuuggggga   agggcaag gugggcag  gc g
    |||||    || ||||    |||||||||||   |||||||| ||||||||  || a
3'  cggug    uu gcuu    ucggaccccuu   ucccguuc cauuuguc  cg c
   a     ----  g    gaua           uuu        a        --  a 
Get sequence
Deep sequencing
358 reads, 0 reads per million, 171 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 64135964-64136071 [-]
sense
ENSRNOT00000018017 ; Cnot3-201; exon 12
Database links

Mature sequence rno-miR-3572

Accession MIMAT0017853
Sequence

65 - 

uuacacuugcccuuuuuuccccag

 - 88

Get sequence
Deep sequencing296 reads, 146 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).