Stem-loop sequence rno-mir-3569

AccessionMI0015437 (change log)
DescriptionRattus norvegicus miR-3569 stem-loop
Gene family MIPF0001797; mir-3569
Literature search

1 open access papers mention rno-mir-3569
(1 sentences)

Stem-loop
   c    ccuuc  c -     ca             gaa 
5'  aguc     cu g gagga  gcagacucagguc   a
    ||||     || | |||||  |||||||||||||    
3'  ucag     ga c cuccu  cgucugaguccag   u
   -    auccc  c u     cg             ggc 
Get sequence
Deep sequencing
146 reads, 0 reads per million, 97 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 89042806-89042881 [+]
intergenic
Database links

Mature sequence rno-miR-3569

Accession MIMAT0017849
Sequence

14 - 

ggaggacagcagacucagguc

 - 34

Get sequence
Deep sequencing93 reads, 75 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).