Stem-loop sequence rno-mir-216b

AccessionMI0015435 (change log)
DescriptionRattus norvegicus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Literature search

12 open access papers mention rno-mir-216b
(39 sentences)

Stem-loop
   ----ugcac    g        ga            --caaa      g  ac 
5'          guug cagacugg  aaucucugcagg      ugugau uc  u
            |||| ||||||||  ||||||||||||      |||||| ||   
3'          caac gucugacu  uuagagauguuc      acacua ag  g
   uacgaacua    a        uc            auucac      a  aa 
Get sequence
Deep sequencing
44192 reads, 125 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr14: 113101078-113101179 [+]
intergenic
Database links

Mature sequence rno-miR-216b-5p

Accession MIMAT0017846
Sequence

20 - 

aaaucucugcaggcaaauguga

 - 41

Get sequence
Deep sequencing31338 reads, 139 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-216b-3p

Accession MIMAT0017847
Sequence

59 - 

cacacuuacuuguagagauu

 - 78

Get sequence
Deep sequencing12790 reads, 85 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).