Stem-loop sequence rno-mir-208b

AccessionMI0015434 (change log)
DescriptionRattus norvegicus miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

39 open access papers mention rno-mir-208b
(195 sentences)

Stem-loop
   -     --caccuccu    --        g          c   cg        cu 
5'  acccc          gcuc  cucucagg aagcuuuuug ucg  uuauguuu  c
    |||||          ||||  |||||||| |||||||||| |||  ||||||||  a
3'  ugggg          ugag  gggagucu uuuggaaaac agc  aauauaag  u
   a     uccacccacg    uc        g          a   ag        cc 
Get sequence
Deep sequencing
194038 reads, 280 reads per million, 208 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr15: 33639510-33639621 [-]
sense
ENSRNOT00000024186 ; Myh7-201; intron 28
Database links

Mature sequence rno-miR-208b-5p

Accession MIMAT0017844
Sequence

27 - 

aagcuuuuugcucgcguuau

 - 46

Get sequence
Deep sequencing350 reads, 39 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-208b-3p

Accession MIMAT0017845
Sequence

62 - 

auaagacgaacaaaaggu

 - 79

Get sequence
Deep sequencing193640 reads, 208 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).