Stem-loop sequence rno-mir-126b

AccessionMI0015433 (change log)
Previous IDsrno-mir-3567
DescriptionRattus norvegicus miR-126b stem-loop
Gene family MIPF0000115; mir-126
Literature search

63 open access papers mention rno-mir-126b
(568 sentences)

Stem-loop
   -  a  ---c   -  g  gc    u    ca            cac      a   -   a 
5'  gc cu    ccg gu cu  gcug ugac  cgcauuauuacu   gguacg guu uga g
    || ||    ||| || ||  |||| ||||  ||||||||||||   |||||| ||| |||  
3'  cg ga    ggc ca ga  cggc acug  guguaauaauga   ccaugc cga acu u
   u  -  ccuc   a  -  aa    c    uc            aaa      g   c   g 
Get sequence
Deep sequencing
122 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr3: 4042464-4042581 [-]
antisense
ENSRNOT00000026318 ; EGFL7-201; intron 7
Clustered miRNAs
< 10kb from rno-mir-126b
rno-mir-126achr3: 4042488-4042560 [+]
rno-mir-126bchr3: 4042464-4042581 [-]
Database links

Mature sequence rno-miR-126b

Accession MIMAT0017843
Previous IDsrno-miR-3567
Sequence

70 - 

uaccaaaaguaauaaugugcug

 - 91

Get sequence
Deep sequencing73 reads, 42 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).