Stem-loop sequence rno-mir-3566

AccessionMI0015431 (change log)
DescriptionRattus norvegicus miR-3566 stem-loop
Stem-loop
       g   c    g ---c         aau        aa   c    c   - u 
5' agcc cug gcgg g    cugcuggga   guaguuca  guu ggca gag c g
   |||| ||| |||| |    |||||||||   ||||||||  ||| |||| ||| | c
3' ucgg gac cguc c    gaugacccu   caucaagu  caa ccgu cuc g a
       -   u    g aacu         cac        aa   u    -   u g 
Get sequence
Deep sequencing
95 reads, 0 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr17: 21353604-21353712 [+]
intergenic
Database links

Mature sequence rno-miR-3566

Accession MIMAT0017841
Sequence

61 - 

cugccuaacaaugaacuacc

 - 80

Get sequence
Deep sequencing18 reads, 16 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).