Stem-loop sequence rno-mir-3065

AccessionMI0015429 (change log)
DescriptionRattus norvegicus miR-3065 stem-loop
Gene family MIPF0001105; mir-3065
Literature search

1 open access papers mention rno-mir-3065
(1 sentences)

Stem-loop
   -  g    g --a    c            a   a   a     g   cacug 
5'  ga gcug c   gcug ccucuucaacaa auc cug ugcug agu     u
    || |||| |   |||| |||||||||||| ||| ||| ||||| |||      
3'  cu cgac g   cggc ggagggguuguu uag gac acgac uca     g
   g  g    g guc    a            a   -   c     -   cccac 
Get sequence
Deep sequencing
517 reads, 0 reads per million, 175 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr10: 109195234-109195336 [+]
antisense
ENSRNOT00000005839 ; Aatk-201; intron 7
Clustered miRNAs
< 10kb from rno-mir-3065
rno-mir-3065chr10: 109195234-109195336 [+]
rno-mir-338chr10: 109195251-109195316 [-]
Database links

Mature sequence rno-miR-3065-5p

Accession MIMAT0017839
Sequence

21 - 

ucaacaaaaucacugaugcu

 - 40

Get sequence
Deep sequencing396 reads, 154 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-3065-3p

Accession MIMAT0017840
Sequence

60 - 

ucagcaccaggauauuguugggga

 - 83

Get sequence
Deep sequencing119 reads, 83 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).