Stem-loop sequence rno-mir-218b

AccessionMI0015428 (change log)
Previous IDsrno-mir-3565
DescriptionRattus norvegicus miR-218b stem-loop
Literature search

13 open access papers mention rno-mir-218b
(29 sentences)

Stem-loop
   u    --aa   --u   u  cg   caug        cgg        uuuacucauaccu g 
5'  guag    agc   gcg ga  uuc    gugcuuga   aaccaugu             c c
    ||||    |||   ||| ||  |||    ||||||||   ||||||||             |  
3'  cauc    uug   cgc cu  aag    cacgaacu   uugguaca             g a
   a    acua   cau   u  aa   acaa        aga        ------------c a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr14: 66923083-66923196 [+]
antisense
ENSRNOT00000005477 ; Slit2-201; intron 15
Clustered miRNAs
< 10kb from rno-mir-218b
rno-mir-218bchr14: 66923083-66923196 [+]
rno-mir-218a-1chr14: 66923083-66923192 [-]
Database links

Mature sequence rno-miR-218b

Accession MIMAT0017838
Previous IDsrno-miR-3565
Sequence

67 - 

caugguuagaucaagcacaa

 - 86

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).