Stem-loop sequence rno-mir-3564

AccessionMI0015427 (change log)
DescriptionRattus norvegicus miR-3564 stem-loop
Literature search

1 open access papers mention rno-mir-3564
(1 sentences)

Stem-loop
   g     -aa  -     acuauua       ucugua      -aa  -      -ca   aa 
5'  uucca   ca gcuuc       ucugucu      ucccuc   gc uuuccc   gug  c
    |||||   || |||||       |||||||      ||||||   || ||||||   |||  a
3'  agggu   gu cgagg       agacaga      agggag   cg aaaggg   cac  c
   -     ggg  a     -----ag       ------      aaa  u      ucc   ga 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 54632008-54632119 [+]
antisense
ENSRNOT00000025424 ; Klhdc4-201; intron 2
Database links

Mature sequence rno-miR-3564

Accession MIMAT0017837
Sequence

69 - 

ugggaaaugcaaagagggaag

 - 89

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).