Stem-loop sequence rno-mir-299b

AccessionMI0015425 (change log)
Previous IDsrno-mir-3563
DescriptionRattus norvegicus miR-299b stem-loop
Gene family MIPF0000186; mir-299
Literature search

1 open access papers mention rno-mir-299b
(1 sentences)

      a   ga -g    -g  -   a   --c      c                     ac 
5' cgg cug  u  gcug  gc ugg uac   aagaag gguuuaccgucccacauacau  u
   ||| |||  |  ||||  || ||| |||   |||||| |||||||||||||||||||||  c
3' guc gac  g  cgac  ug gcc aug   uucuuu ccaaauggcaggguguaugua  a
      -   ag ga    ag  c   -   aac      a                     aa 
Get sequence
Deep sequencing
11854 reads, 2.97 reads per million, 337 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133859295-133859412 [-]
Clustered miRNAs
< 10kb from rno-mir-299b
rno-mir-495chr6: 133868288-133868367 [+]
rno-mir-543chr6: 133866660-133866739 [+]
rno-mir-666chr6: 133866523-133866621 [+]
rno-mir-1193chr6: 133864698-133864817 [+]
rno-mir-679chr6: 133864564-133864700 [+]
rno-mir-494chr6: 133864370-133864452 [+]
rno-mir-329chr6: 133862168-133862264 [+]
rno-mir-758chr6: 133861498-133861575 [+]
rno-mir-323chr6: 133861199-133861284 [+]
rno-mir-380chr6: 133860490-133860566 [+]
rno-mir-3579chr6: 133860473-133860585 [-]
rno-mir-299achr6: 133859324-133859386 [+]
rno-mir-299bchr6: 133859295-133859412 [-]
rno-mir-411chr6: 133858849-133858924 [+]
rno-mir-379chr6: 133857700-133857784 [+]
Database links

Mature sequence rno-miR-299b-5p

Accession MIMAT0017833
Previous IDsrno-miR-3563-5p

33 - 


 - 52

Get sequence
Deep sequencing4886 reads, 264 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-299b-3p

Accession MIMAT0017834
Previous IDsrno-miR-3563-3p

65 - 


 - 81

Get sequence
Deep sequencing6961 reads, 301 experiments
Evidence experimental; SOLiD [1]
Predicted targets


PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).