Stem-loop sequence rno-mir-3560

AccessionMI0015422 (change log)
DescriptionRattus norvegicus miR-3560 stem-loop
Literature search

1 open access papers mention rno-mir-3560
(4 sentences)

Stem-loop
      caca   agaccag    ac    cc a       --g   -     -cau   aua 
5' ccu    ugc       gcuu  cuuc  c aauccuu   ccc gggug    ugc   c
   |||    |||       ||||  ||||  | |||||||   ||| |||||    |||   a
3' gga    acg       cgag  ggag  g uuaggaa   ggg cccac    acg   a
      --ag   ----aga    ca    -a a       aca   a     uuuu   aua 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 16117863-16117974 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3560
rno-mir-500chrX: 16121332-16121411 [+]
rno-mir-501chrX: 16117874-16117957 [+]
rno-mir-3560chrX: 16117863-16117974 [-]
rno-mir-362chrX: 16117170-16117234 [+]
rno-mir-188chrX: 16110270-16110349 [+]
rno-mir-532chrX: 16109870-16109948 [+]
Database links

Mature sequence rno-miR-3560

Accession MIMAT0017829
Sequence

30 - 

caaauccuugcccgggugcauu

 - 51

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).