Stem-loop sequence rno-mir-3559

AccessionMI0015421 (change log)
DescriptionRattus norvegicus miR-3559 stem-loop
Literature search

5 open access papers mention rno-mir-3559
(16 sentences)

Stem-loop
   cucagaagaaagccuuuuu   u                         --gauc   g 
5'                    cuc cugcgugacagacuuaguacuacau      cau u
                      ||| |||||||||||||||||||||||||      |||  
3'                    gag gacgugcugucugagucaugaugua      gua u
   -agagaaaccuaaaaaaau   u                         aucaaa   a 
Get sequence
Deep sequencing
31987 reads, 10.2 reads per million, 480 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 75459241-75459355 [-]
sense
ENSRNOT00000003714 ; Zdhhc15-201; intron 10
Database links

Mature sequence rno-miR-3559-5p

Accession MIMAT0017827
Sequence

29 - 

ugacagacuuaguacuacauga

 - 50

Get sequence
Deep sequencing24485 reads, 473 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-3559-3p

Accession MIMAT0017828
Sequence

69 - 

auguaguacugagucugucgug

 - 90

Get sequence
Deep sequencing7499 reads, 427 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).