Stem-loop sequence rno-mir-291b

AccessionMI0015417 (change log)
DescriptionRattus norvegicus miR-291b stem-loop
Gene family MIPF0000068; mir-290
Literature search

4 open access papers mention rno-mir-291b
(49 sentences)

Stem-loop
   --c ga   ugga   u   a       u cau         g  - c cu    gg 
5'    g  ucu    agu gga cacaggg c   caaagugga gc c u  ccgu  c
      |  |||    ||| ||| ||||||| |   ||||||||| || | |  ||||   
3'    c  agg    ucg ccu gugucuc g   guuuuaccu cg g a  ggcg  u
   cca uc   ----   c   -       u auu         a  u a ag    gu 
Get sequence
Deep sequencing
299 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 64537831-64537938 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-291b
rno-mir-290chr1: 64538705-64538785 [-]
rno-mir-291achr1: 64538407-64538488 [-]
rno-mir-292chr1: 64538119-64538200 [-]
rno-mir-291bchr1: 64537831-64537938 [-]
rno-mir-293chr1: 64537107-64537178 [-]
rno-mir-294chr1: 64536746-64536816 [-]
rno-mir-295-1chr1: 64536623-64536703 [-]
Database links

Mature sequence rno-miR-291b

Accession MIMAT0017822
Sequence

64 - 

aaagugcauccauuuuguuagu

 - 85

Get sequence
Deep sequencing250 reads, 50 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).