Stem-loop sequence rno-mir-3557

AccessionMI0015415 (change log)
DescriptionRattus norvegicus miR-3557 stem-loop
Gene family MIPF0000168; mir-378
Literature search

1 open access papers mention rno-mir-3557
(1 sentences)

Stem-loop
   -   g   aa      ---u         c            a    --a   c    u 
5'  agc ggg  ggugac    ccacucagg cuucugacucca gucc   gug uauu c
    ||| |||  ||||||    ||||||||| |||||||||||| ||||   ||| ||||  
3'  ucg ucc  ccacug    ggugggucc gaggacugaggu cagg   cac augg g
   g   g   -c      ucuc         c            c    aca   a    a 
Get sequence
Deep sequencing
672 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 56726128-56726240 [+]
antisense
ENSRNOT00000023661 ; Ppargc1b-202; intron 1
Clustered miRNAs
< 10kb from rno-mir-3557
rno-mir-3557chr18: 56726128-56726240 [+]
rno-mir-378achr18: 56726150-56726214 [-]
Database links

Mature sequence rno-miR-3557-5p

Accession MIMAT0017819
Sequence

25 - 

gccuucugacuccaaguccagu

 - 46

Get sequence
Deep sequencing27 reads, 22 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-3557-3p

Accession MIMAT0017820
Sequence

63 - 

acacaggaccuggagucaggag

 - 84

Get sequence
Deep sequencing622 reads, 152 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).