Stem-loop sequence rno-mir-191b

AccessionMI0015413 (change log)
Previous IDsrno-mir-3555
DescriptionRattus norvegicus miR-191b stem-loop
Gene family MIPF0000194; mir-191
Literature search

19 open access papers mention rno-mir-191b
(42 sentences)

Stem-loop
   c     g  g   ---a   a   g   a  g    a     -aagu       gaa  -  c 
5'  agggc cu cuc    ggc gga agc gg aacg aaucc     gcagcug   ug cu u
    ||||| || |||    ||| ||| ||| || |||| |||||     |||||||   || ||  
3'  ucucg ga gag    ccg ccu ucg cc uugc uuagg     cgucgac   ac ga g
   -     g  g   guua   a   g   c  g    c     guuuu       --a  a  g 
Get sequence
Deep sequencing
707 reads, 0 reads per million, 186 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 117354348-117354467 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-191b
rno-mir-425chr8: 117354821-117354903 [+]
rno-mir-191achr8: 117354364-117354454 [+]
rno-mir-191bchr8: 117354348-117354467 [-]
Database links

Mature sequence rno-miR-191b

Accession MIMAT0017817
Previous IDsrno-miR-3555
Sequence

29 - 

gaacgaaauccaagugcagcu

 - 49

Get sequence
Deep sequencing701 reads, 186 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).