Stem-loop sequence rno-mir-449c

AccessionMI0015402 (change log)
DescriptionRattus norvegicus miR-449c stem-loop
Gene family MIPF0000133; mir-449
Literature search

7 open access papers mention rno-mir-449c
(15 sentences)

Stem-loop
   aa  --g        u    ca  c      uu        g     -a  ac 
5'   gc   ugggugug caga  gg agugca  gcuagcug cuguu  ga  u
     ||   |||||||| ||||  || ||||||  |||||||| |||||  ||   
3'   cg   auucacgu gucu  cc ucacgu  cgaucggu gacaa  cu  u
   --  aag        c    -c  a      --        -     cc  gc 
Get sequence
Deep sequencing
2649 reads, 14.2 reads per million, 240 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 44896066-44896164 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-449c
rno-mir-449cchr2: 44896066-44896164 [+]
rno-mir-449achr2: 44897601-44897691 [+]
Database links

Mature sequence rno-miR-449c-5p

Accession MIMAT0017803
Sequence

20 - 

aggcagugcauugcuagcugg

 - 40

Get sequence
Deep sequencing2635 reads, 239 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-449c-3p

Accession MIMAT0017804
Sequence

45 - 

uagaacuucgucccaac

 - 61

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).