Stem-loop sequence rno-mir-203b

AccessionMI0015399 (change log)
Previous IDsrno-mir-3545
DescriptionRattus norvegicus miR-203b stem-loop
Gene family MIPF0000108; mir-203
Literature search

29 open access papers mention rno-mir-203b
(219 sentences)

Stem-loop
      g  gcc c   c u       g           c  a    u    -  a  g gc 
5' gcu uc   g ugc g gcgcgcc ggucuaguggu cu aaca uuca ca uu c  u
   ||| ||   | ||| | ||||||| ||||||||||| || |||| |||| || || |   
3' cga ag   c acg c cgcgcgg ccaggucacca ga uugu aagu gu aa g  a
      -  aca -   u -       a           a  a    c    u  c  - ac 
Get sequence
Deep sequencing
49539 reads, 44.9 reads per million, 405 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 136704947-136705061 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-203b
rno-mir-203achr6: 136704961-136705057 [+]
rno-mir-203bchr6: 136704947-136705061 [-]
Database links

Mature sequence rno-miR-203b-5p

Accession MIMAT0017799
Previous IDsrno-miR-3545-5p
Sequence

31 - 

agugguccuaaacauuucac

 - 50

Get sequence
Deep sequencing16 reads, 15 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-203b-3p

Accession MIMAT0017800
Previous IDsrno-miR-3545-3p
Sequence

69 - 

uugaacuguuaagaaccacugg

 - 90

Get sequence
Deep sequencing49461 reads, 405 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).