Stem-loop sequence rno-mir-3544

AccessionMI0015398 (change log)
DescriptionRattus norvegicus miR-3544 stem-loop
Gene family MIPF0001349; mir-3544
Stem-loop
   c     aa       aa   a   a    a      c   a  gc 
5'  gguug  gggggug  gaa ggc ucau uaggag uga ug  u
    |||||  |||||||  ||| ||| |||| |||||| ||| ||   
3'  ucaac  cccccac  cuu ccg agua guccuc acu ac  g
   -     --       -c   g   c    c      a   a  gu 
Get sequence
Deep sequencing
347 reads, 0 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133705932-133706019 [-]
antisense
ENSRNOT00000053650 ; Mir337-201; exon 1
Clustered miRNAs
< 10kb from rno-mir-3544
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-493chr6: 133699509-133699592 [+]
Database links

Mature sequence rno-miR-3544

Accession MIMAT0017798
Sequence

55 - 

aacuccugcaugacgccguuccc

 - 77

Get sequence
Deep sequencing133 reads, 52 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).