Stem-loop sequence rno-mir-3543-1

AccessionMI0015397 (change log)
Previous IDsrno-mir-3543
DescriptionRattus norvegicus miR-3543-1 stem-loop
Gene family MIPF0002097; mir-3543
Stem-loop
   u    caaa     -------a     g   ----     ca      g        -a     u 
5'  gauu    ccagg        gucga uga    ugguu  aaccac aguuugac  auggu c
    ||||    |||||        ||||| |||    |||||  |||||| ||||||||  |||||  
3'  cuga    ggucc        cagcu acu    accaa  uuggug ucgagcug  uacca a
   a    ----     aaacuuug     a   gaga     ac      -        ag     a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133715345-133715459 [-]
sense
ENSRNOT00000072399 ; rno-mir-3543-201; exon 4
Clustered miRNAs
< 10kb from rno-mir-3543-1
rno-mir-136chr6: 133716761-133716842 [+]
rno-mir-434-2chr6: 133716248-133716328 [+]
rno-mir-3543-2chr6: 133716215-133716329 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-337chr6: 133705920-133706016 [+]
Database links

Mature sequence rno-miR-3543

Accession MIMAT0017797
Sequence

11 - 

caggagucgagugaugguucaaa

 - 33

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).