Stem-loop sequence gga-mir-3535

AccessionMI0015388 (change log)
DescriptionGallus gallus miR-3535 stem-loop
Gene family MIPF0001751; mir-3535
Literature search

2 open access papers mention gga-mir-3535
(4 sentences)

Stem-loop
   u       augaug   -         aaau   gau   a 
5'  gcuggau      acu gauuaucug    gcu   gaa c
    |||||||      ||| |||||||||    |||   ||| c
3'  cgaccua      uga cugauagau    uga   cuu a
   a       --gucg   a         cucc   aau   c 
Get sequence
Deep sequencing
2273 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 15324645-15324726 [-]
sense
ENSGALT00000012486 ; NCL-201; intron 12
ENSGALT00000033265 ; NCL-202; intron 12
Database links

Mature sequence gga-miR-3535

Accession MIMAT0016386
Sequence

5 - 

ggauaugaugacugauuaucugaaa

 - 29

Get sequence
Deep sequencing1026 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).