Stem-loop sequence gga-mir-3532

AccessionMI0015385 (change log)
DescriptionGallus gallus miR-3532 stem-loop
Stem-loop
   u      cu   gu  -          gc  uu   c   au 
5'  gugcuu  cac  ug cacugcagcu  uc  ggg uua  u
    ||||||  |||  || ||||||||||  ||  ||| |||  a
3'  cacgaa  gug  ac gugacgucgg  gg  ccc agu  a
   a      au   gu  u          -a  uu   -   cu 
Get sequence
Deep sequencing
1867 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 32991425-32991508 [-]
sense
ENSGALT00000016012 ; NOVA1-201; intron 2
ENSGALT00000045281 ; NOVA1-202; intron 2
ENSGALT00000045208 ; NOVA1-203; intron 2
Database links

Mature sequence gga-miR-3532-5p

Accession MIMAT0027031
Sequence

13 - 

guugcacugcagcugcucuugg

 - 34

Get sequence
Deep sequencing39 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-3532-3p

Accession MIMAT0016383
Sequence

53 - 

uuggaggcugcagugucauggu

 - 74

Get sequence
Deep sequencing1828 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).