Stem-loop sequence gga-mir-3531

AccessionMI0015383 (change log)
DescriptionGallus gallus miR-3531 stem-loop
Literature search

1 open access papers mention gga-mir-3531
(3 sentences)

Stem-loop
   u            --c     u     g       u   gu uc 
5'  ugcagaucaaag   cuccu guuug guuguaa gaa  g  g
    ||||||||||||   ||||| ||||| ||||||| |||  |   
3'  acgucuaguuuc   gagga caaac caacguu cuu  u  a
   a            aca     -     a       c   ug ca 
Get sequence
Deep sequencing
220 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 443912-443998 [-]
sense
ENSGALT00000000793 ; SDC3-201; intron 1
Database links

Mature sequence gga-miR-3531-5p

Accession MIMAT0016381
Sequence

16 - 

uccuuguuuggguuguaauga

 - 36

Get sequence
Deep sequencing21 reads, 4 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-3531-3p

Accession MIMAT0027030
Sequence

52 - 

ccuugcaacacaaacaggagaca

 - 74

Get sequence
Deep sequencing199 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).