Stem-loop sequence gga-mir-3530

AccessionMI0015381 (change log)
DescriptionGallus gallus miR-3530 stem-loop
Literature search

1 open access papers mention gga-mir-3530
(1 sentences)

Stem-loop
     a     --au       -   u               g ggcc 
5' ga ggcug    gcgcccg cuc gcucgcaccauugug c    g
   || |||||    ||||||| ||| ||||||||||||||| |    a
3' cu ccggc    cgcgggu ggg cgagugugguaacac g    a
     c     cggu       a   u               - aaac 
Get sequence
Deep sequencing
751 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 25408507-25408595 [+]
intergenic
Database links

Mature sequence gga-miR-3530-5p

Accession MIMAT0027029
Sequence

17 - 

gcucugcucgcaccauugugg

 - 37

Get sequence
Deep sequencing659 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-3530-3p

Accession MIMAT0016379
Sequence

53 - 

caauggugugagcugggaugg

 - 73

Get sequence
Deep sequencing92 reads, 4 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).