Advanced warning: 8th Sept 2010 - the miRBase website should be considered to be at risk of significant downtime due to essential hardware maintenance.

Stem-loop sequence MI0015380

Accession MI0015380
ID gga-mir-3529
Description Gallus gallus miR-3529 stem-loop
Stem-loop 
       -c     aa  c     -    -c       --g    ga 
ggccgug  gcccu  gg agacu guga  uuguugu   gugg  u
|||||||  |||||  || ||||| ||||  |||||||   ||||   
ccggcgc  cggga  cc ucuga cacu  aacaaca   uacc  g
       ca     ga  u     u    aa       aca    ga
Get sequence
Genome context
Coordinates (WASHUC2) Overlapping transcripts
10: 14823529-14823619 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-3529
gga-mir-1720 10: 14823390-14823454 [-]
gga-mir-7-2 10: 14823525-14823623 [-]
gga-mir-3529 10: 14823529-14823619 [+]

Mature sequence MIMAT0016378

Accession MIMAT0016378
ID gga-miR-3529
Sequence

15 -  

aggcagacugugacuuguugu

 - 35

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
"Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).