Stem-loop sequence bra-MIR2111a

AccessionMI0015372 (change log)
DescriptionBrassica rapa miR2111a stem-loop
Gene family MIPF0000754; MIR2111
Literature search

1 open access papers mention bra-MIR2111a
(1 sentences)

Stem-loop
     ga    -aa    ---         cc                    -uuu      -ugauuau       ---ac    c 
5' ca  ugac   guau   uggugagga  ggguaaucugcauccugagg    aaagcu        acgcaua     augc g
   ||  ||||   ||||   |||||||||  ||||||||||||||||||||    ||||||        |||||||     ||||  
3' gu  auug   caug   aucauuccu  uccauuaggcguagggcucc    uuucga        uguguau     uacg a
     ac    gca    cau         uc                    ugau      uaagauuu       caaua    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA3: 15829023-15829183 [-]
intergenic
Database links

Mature sequence bra-miR2111a-5p

Accession MIMAT0016368
Previous IDsbra-miR2111a
Sequence

29 - 

uaaucugcauccugagguuua

 - 49

Get sequence
Evidence by similarity; MI0010630

Mature sequence bra-miR2111a-3p

Accession MIMAT0016369
Previous IDsbra-miR2111a*
Sequence

111 - 

guccucgggaugcggauuacc

 - 131

Get sequence
Evidence by similarity; MI0010630

References

1
PMID:19854858 "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ Plant Physiol. 151:2120-2132(2009).